| Publication Type: | Journal Article |
| Year of Publication: | 2023 |
| Authors: | M. S. Suelo, Luceño, A. J. M., Mohagan, A. B., Cruz, R. Y. Dela |
| Journal: | International Journal of Applied Science and Research |
| Volume: | 6 |
| Issue: | 2 |
| Start Page: | 44 |
| Pagination: | 44-50 |
| Date Published: | 04/2023 |
| Keywords: | BARCODING, BAYESIAN INFERENCE, COI, DNA, MAXIMUM LIKELIHOOD, MTDNA, PHILIPPINES, SPHINGIDAE |
| Abstract: | "The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade." |
| URL: | https://doi.org/10.56293/IJASR.2022.5505 |
Molecular identification of hawkmoths (Lepidoptera: Sphingidae) in selected areas of Mt. Kitanglad based on cytochrome oxidase subunit I (COI) gene sequence
Taxonomic name: